Procédé de dépistage de Xanthomonas axonopodis pv. phaseoli

TitreProcédé de dépistage de Xanthomonas axonopodis pv. phaseoli
Type de publicationBrevet
Année2012
LangueFrançais
Date de publication2012-07-20
Numéro de brevetFR2970480 A1
Classification internationale (IPC)C07H21/00; C12Q1/04; C12Q1/68; C12R1/64
AuteurBoureau, Tristan , Chhel, Fabien , Hunault, Gilles, Kerkoud, Mohammed , Lardeux, Frédéric , Manceau, Charles , Poussier, Stéphane , Saubion, Frédéric
PaysFrance
Titre internationalScreening Xanthomonas axonopodis pathovar phaseoli in biological sample, comprises detecting combination of two genes of the combination AvrBsT/Xac3090, the combination AvrBsT/XopP, and the combination AvrBsT/AvrXccB
OrganismeInstitut national de la recherche agronomique ; DIAG-GENE
VilleAngers
Résumé en anglais

Screening Xanthomonas axonopodis pathovar phaseoliin a biological sample, comprises detecting a combination (C1) of two genes of the combination AvrBsT/Xac3090, the combination AvrBsT/XopP, and the combination AvrBsT/AvrXccB, where the result of the screening process is positive if the presence of two genes of the combination (C1) is detected in the biological sample. Independent claims are included for: (1) a nucleotide probe or primer used in a method of screening Xanthomonas axonopodis pathovar phaseoli, where the primer or the probe has a length of 12-30 nucleotides and comprising at least 12 consecutive nucleotides from a nucleic acid of the nucleic acid sequence of SEQ ID NOs: 5-12 (e.g. ccatgctgagcacggtcatt (SEQ ID NO: 5), cgccttccagttgctgacat (SEQ ID NO: 6), acgagcccttcccaaactagc (SEQ ID NO: 7), taccaacatcgtacgcttccc (SEQ ID NO: 8), cgtcagtgagtgctcggttg (SEQ ID NO: 9) and tcagagccctggaagcaaga (SEQ ID NO: 10)), and the nucleic acids of complementary sequence; and (2) a kit for detection of Xanthomonas axonopodis pathovar phaseoliin a biological sample, comprising two pairs of primers for amplifying the combination of the two genes (C1) and the nucleotide probe or primer.

Résumé en français

La présente invention est relative à un procédé de dépistage de Xanthomonas axonopodis pv. phaseoli dans un échantillon biologique comprenant une étape de détection de la présence éventuelle d'une combinaison de deux gènes, ladite combinaison comprenant le gène AvrBsT et un gène choisi parmi le gène Xac3090, le gène XopP et le gène AvrXccB dans ledit échantillon. La présente invention a également pour objet des acides nucléiques utilisables en tant que sondes ou amorces pour la détection de ce pathovar dans un échantillon biologique et un kit de dépistage contenant au moins un desdits acides nucléiques.

URL de la noticehttp://okina.univ-angers.fr/publications/ua13590
Numéro(s) de prioritéFR20110050388 20110118
Date de dépôt 2011-01-18